Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.078948 |
Chromosome: | chromosome 13 |
Location: | 5137104 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g607100 | CYG6 | (1 of 22) PTHR11017//PTHR11017:SF145 - LEUCINE-RICH REPEAT-CONTAINING PROTEIN // SUBFAMILY NOT NAMED; Adenylate/guanylate cyclase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCACACACACGCACACACACACACGCACACACACACACACACACACA |
Internal bar code: | GCGGGTTGCATGGTTTTTGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 258 |
LEAP-Seq percent confirming: | 14.2857 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGCGTCGCATTTGAACAA |
Suggested primer 2: | CGTTGGTCGAAAAGCCGATC |