| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.078988 |
| Chromosome: | chromosome 8 |
| Location: | 1912605 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g367800 | NDH2 | Nucleoside diphosphate hydrolase; (1 of 1) 3.6.1.13//3.6.1.22 - ADP-ribose diphosphatase / ADPR-PPase // NAD(+) diphosphatase / NADP pyrophosphatase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCGGCACCCTTGCGCAACGCTAGCCGCCTGCGCAATCACGCCCACCC |
| Internal bar code: | CTCTGACTATCGGGTGGTCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3286 |
| LEAP-Seq percent confirming: | 90.6977 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTCCTTGGACCGCAGAAT |
| Suggested primer 2: | GGGTGGGTGAGGAATGAGTG |