Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.078992 |
Chromosome: | chromosome 3 |
Location: | 3082241 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g164150 | (1 of 12) IPR003439//IPR003593//IPR027417 - ABC transporter-like // AAA+ ATPase domain // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCGACTACCCTACTACAGACAAAACGGTTGCCAAAGAAGGTACTCTC |
Internal bar code: | TTTCAGCGAGCGCCTAAGCACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 447 |
LEAP-Seq percent confirming: | 19.5122 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 33 |
LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACTATGATGCACACGCCG |
Suggested primer 2: | CCAGCTATGGTAGTCTGCGG |