| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078994 |
| Chromosome: | plastome |
| Location: | 24178 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802274 | 2717055,ChreCp012,rpl2 | 50S ribosomal protein L2; (1 of 2) IPR005880 - Ribosomal protein L2, bacterial/organellar-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAACGTGCTAATTGACCACCTGAGCCTGGTTGGAATTCAACGTTATGTA |
| Internal bar code: | TTGCACTGAGTCAAAATGCATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 175 |
| LEAP-Seq percent confirming: | 25.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTGCCAATGCGTAGTTGA |
| Suggested primer 2: | CCCCTTCGGGCAAGTAAACT |