Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.079005 |
Chromosome: | chromosome 3 |
Location: | 5169206 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g181150 | ROC106,RSP22,ODA-LC8,DLL1,LC8,FLA14 | Dynein arm light chain 8; (1 of 1) PTHR11886//PTHR11886:SF33 - DYNEIN LIGHT CHAIN // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAACTCCCGCGCGCCCGAAGCTCCGCGGCCGCTTAGCCCGACTTGAA |
Internal bar code: | AGTTATACGGTGCAAGCCTAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 864 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCGCACAACCACTACTCAC |
Suggested primer 2: | ATTAGACTGCCCCTTGTGCC |