| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.079047 |
| Chromosome: | chromosome 2 |
| Location: | 8573652 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141050 | AGO1 | (1 of 2) K11593 - eukaryotic translation initiation factor 2C (ELF2C, AGO); Argonaute-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATGGGGCCTTGCGGGGCAGGGCGGGAAGAGGCACAGGCAAAAGGAGG |
| Internal bar code: | GGTGTCGAAGGTGCTTATCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 282 |
| LEAP-Seq percent confirming: | 5.55556 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGATGTGCACACTACGTT |
| Suggested primer 2: | CCGACTACATCCGTACAGCC |