Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.079058 |
Chromosome: | plastome |
Location: | 160092 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802323 | 2717034,atpB,ChreCp058 | (1 of 1) K02112 - F-type H+-transporting ATPase subunit beta (ATPF1B, atpD); ATPase beta chain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCTACTTTTGAATCAGATAAGTTCTTTTCAACAATAACACCAGATTCT |
Internal bar code: | TACTGCAATGAACATGATGTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 134 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGGGAAGGAGGAGGTTCTT |
Suggested primer 2: | ATGTTGTAGCAGGAGCAGGG |