| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.079066 |
| Chromosome: | chromosome 6 |
| Location: | 365028 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g251450 | NIC7 | (1 of 1) 2.5.1.72 - Quinolinate synthase / Quinolinate synthetase; Quinolinate synthetase A | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGTCCCTACCCCTCGCAGCATTGTACGGTTGCGCCCTCTTGACCTTCA |
| Internal bar code: | TAAGAGAATCTCCTTGGCCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1702 |
| LEAP-Seq percent confirming: | 47.0588 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 102 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAGATGAACACCCTGGCC |
| Suggested primer 2: | GTTGTTGGCTGGCTTCACTG |