| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.079069 |
| Chromosome: | chromosome 6 |
| Location: | 2380746 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g268400 | HFO9 | (1 of 33) K11254 - histone H4 (H4); Histone H4 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACCGTGTCTTGCCCCTTCCCCCAGGCTGCCTGCCTCTCCATCCAAAC |
| Internal bar code: | CTGATACGTGCGGCGTAGTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 830 |
| LEAP-Seq percent confirming: | 26.3158 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCACAGTAGGACCCAGAAC |
| Suggested primer 2: | AAGTCCTGGGCAATCTCACG |