Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.079076 |
Chromosome: | chromosome 11 |
Location: | 1460437 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g469400 | HIK4,HKR4,HIK | (1 of 1) IPR001789//IPR011006//IPR013761 - Signal transduction response regulator, receiver domain // CheY-like superfamily // Sterile alpha motif/pointed domain; response regulator of two-component system | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGAGGCGCCCCAGCTTGCGAGTTATTGCCACATACCAAACAAGAGCCAG |
Internal bar code: | TGGTCTATCGGAAGGAGGGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 186 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTGGATGCCGCCAAGAATT |
Suggested primer 2: | GCTTCGTTGCAGCACTGAAA |