| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.079088 |
| Chromosome: | chromosome 1 |
| Location: | 7174078 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g051450 | (1 of 2) PF13867 - Sin3 binding region of histone deacetylase complex subunit SAP30 (SAP30_Sin3_bdg) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAATGCAGCAGTCAGTCATCGACGCTTGGCGGCTTGGTGCACAATAGT |
| Internal bar code: | CTTGCCGAGCTGACGTCTCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1191 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTATTGCGCCTGGATTG |
| Suggested primer 2: | TGGCGGAACAATGAGAAGCT |