Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.079109 |
Chromosome: | chromosome 1 |
Location: | 6684292 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g047650 | (1 of 1) K10268 - F-box and leucine-rich repeat protein 2/20 (FBXL2_20) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGACGCTACGCCCAGGTCACAACGGCCCCGTTTTGCTCCTGCAACTCG |
Internal bar code: | CTATGCGTGCGGAGAGGGGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 629 |
LEAP-Seq percent confirming: | 92.8571 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATGACCCCCTCCACACACA |
Suggested primer 2: | CAAGAGCAGAGGGTGGTGAG |