| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.079169 |
| Chromosome: | plastome |
| Location: | 23216 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802273 | 2717054,ChreCp011,rpl23 | (1 of 1) PTHR11620//PTHR11620:SF20 - 60S RIBOSOMAL PROTEIN L23A // 50S RIBOSOMAL PROTEIN L23, CHLOROPLASTIC; 50S ribosomal protein L23 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGTAATCTTTTGCTTATTTTAGAAGCAAGTATCATATAAATAAAATTG |
| Internal bar code: | AATTAATTTTCGATCGCAGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 74 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAATGCGAGCATTACGGTT |
| Suggested primer 2: | ACGCATATTCCACCACGTCA |