Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.079234 |
Chromosome: | chromosome 3 |
Location: | 3190222 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g165100 | PSAI1 | (1 of 1) K02696 - photosystem I subunit VIII (psaI); Photosystem I reaction center subunit PsaI | 5'UTR |
Cre03.g165150 | (1 of 31) IPR003594 - Histidine kinase-like ATPase, C-terminal domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATAACAAAACACGTACGCGCTTAGCATGTTGCGACGCTTAGGAACCAA |
Internal bar code: | ATATTATAGGACTCTTTGAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3964 |
LEAP-Seq percent confirming: | 97.5 |
LEAP-Seq n confirming: | 39 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACATGCCCTGACCTCTCAC |
Suggested primer 2: | ACGGCAGAACAAGGGAAGAG |