Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.079238 |
Chromosome: | plastome |
Location: | 8122 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802265 | ChreCp003,2716966,chlB | (1 of 1) K04039 - light-independent protochlorophyllide reductase subunit B (chlB); light-independent protochlorophyllide reductase subunit B | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCAATATTTGTATTCCCGAAGGAGAAGGGGAAGGGGAGCAGACTAAA |
Internal bar code: | TATAAGTGTTAAGTATTGTCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 189 |
LEAP-Seq percent confirming: | 28.5714 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGAAAACCAGGCTGCTTGG |
Suggested primer 2: | CCCGCTCATATCGGTGTGTT |