| Insertion cassette: | CIB2 | 
| Side of cassette: | 5' | 
| Strand: | - | 
| Strain: | CLIP2.079241 | 
| Chromosome: | chromosome 12 | 
| Location: | 5131147 | 
| Confidence (%): | 80 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre12.g801426 | (1 of 726) IPR011009 - Protein kinase-like domain | outside_mRNA | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATATTCAAGTACCCAACTATGATTAGCTGTGGGGGCTATTTCCAGAACT | 
| Internal bar code: | TTACTTCGGTCTTTGATGAACT | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3856 | 
| LEAP-Seq percent confirming: | 1.06383 | 
| LEAP-Seq n confirming: | 1 | 
| LEAP-Seq n nonconfirming: | 93 | 
| LEAP-Seq n unique pos: | 94 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTACACACAGGTCTCACC | 
| Suggested primer 2: | CGCTTACCGCAGATTTGAGC |