| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.079254 |
| Chromosome: | chromosome 6 |
| Location: | 3277534 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g277200 | BIOA,BIO1 | Diaminopelargonic acid synthase; (1 of 1) 6.3.3.3 - Dethiobiotin synthase / DTB synthetase | 3'UTR |
| Cre06.g277250 | (1 of 32) IPR006502 - Protein of unknown function PDDEXK-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTCCCGCCCCACGCATCAGGAAGAGGGACACTGACCGAACGGTGGCGC |
| Internal bar code: | GGGATTCGCTCGCAGACACATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3785 |
| LEAP-Seq percent confirming: | 81.5385 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTCAGCAGTGTACGGGAA |
| Suggested primer 2: | CTCTGGGAGCACTTGGTCAG |