| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.079262 |
| Chromosome: | chromosome 11 |
| Location: | 927009 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467656 | (1 of 9) IPR007112//IPR009009 - Expansin/pollen allergen, DPBB domain // RlpA-like double-psi beta-barrel domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGGCTGGTAGGGAGTTGTAACCAACACCCACCAACTTGCCCACCAAC |
| Internal bar code: | GGCGCGTATCGCCGGGTGTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1139 |
| LEAP-Seq percent confirming: | 46.6667 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTGTGACCAACGCCCTTG |
| Suggested primer 2: | GTTCTGCCTGGACGAACTCA |