| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.079284 |
| Chromosome: | chromosome 6 |
| Location: | 1447577 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g260100 | UAA3 | UDP-galactose transporter; (1 of 2) K15276 - solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2 (SLC35B2, PAPST1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCACCCCTGCCCAACACCATCTCACTAGGTTCAGACACATGCTAGGGA |
| Internal bar code: | CGTTGGATAATTGCGGAATTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2513 |
| LEAP-Seq percent confirming: | 61.6279 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATTCATGTTCCCCGATGC |
| Suggested primer 2: | TGTAGAGGCTGTGTGCTGTG |