| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.079326 |
| Chromosome: | chromosome 17 |
| Location: | 5965285 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g742300 | GST14,FAP179 | Flagellar Associated Protein 179; (1 of 6) K00799 - glutathione S-transferase (GST, gst) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCCCCACCGCTCCATCCAGCTTTCTCCGCTTCCCCACCTCCTTCTTGA |
| Internal bar code: | GTCCAGGTGCAAGTTCGCCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 834 |
| LEAP-Seq percent confirming: | 37.8378 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATTGGTTGCAGCTGCCAAA |
| Suggested primer 2: | CCATGACTACGGCCCATCTC |