| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.079331 |
| Chromosome: | chromosome 7 |
| Location: | 4655862 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g344702 | (1 of 24) IPR006553 - Leucine-rich repeat, cysteine-containing subtype | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCAGGTCAATCACGCCCTGCCTCCTCCGCCTCCGCACCACTTGCTGCC |
| Internal bar code: | TGTGTACGTTGTTGCCGAGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 523 |
| LEAP-Seq percent confirming: | 57.1429 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATGTGGGATGAGCGGGAG |
| Suggested primer 2: | AAGAGTTTCAGGCACTCGGG |