| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.079346 |
| Chromosome: | chromosome 1 |
| Location: | 3991824 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g026150 | (1 of 3) 3.4.24.59 - Mitochondrial intermediate peptidase | 3'UTR | |
| Cre01.g026200 | PPR9 | PentatricoPeptide Repeat protein 9; (1 of 6) PF01535 - PPR repeat (PPR) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCCCCTGGTTCGGAGTGAATGAAGGCGTGAGGCGCGCCGCAGTCCGT |
| Internal bar code: | TGGGAGTCGGGCATTTAAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2127 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAGCTGAAACGGACATGA |
| Suggested primer 2: | ATGACGCTTCTGGGTGAGTG |