| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.079372 |
| Chromosome: | chromosome 2 |
| Location: | 7877086 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g145800 | MDN3,MDH3 | NAD-dependent malate dehydrogenase 3; (1 of 1) K00025 - malate dehydrogenase (MDH1) | 3'UTR |
| Cre02.g145850 | FAP112 | Flagellar Associated Protein 112; (1 of 3) IPR006130 - Aspartate/ornithine carbamoyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCACGGGGCCGTAACCCAAGCCGTAACCATGGGCCGCAAACGATGATA |
| Internal bar code: | GACTATGTTATACCTTGCAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2868 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGGAGTCAGAGGAGGGCA |
| Suggested primer 2: | CTGGTAGCGTGAACCACCAT |