| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.079384 |
| Chromosome: | plastome |
| Location: | 17481 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802269 | ChreCp007,clpP,2717015 | (1 of 9) 3.4.21.92 - Endopeptidase Clp / Protease Ti; ATP-dependent Clp protease proteolytic subunit | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATATTTTATCTAAAGATTTTTCACCTAATCAAGACAAAGATTCTGCTA |
| Internal bar code: | CTCTTGGGGCTAGGTACCATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 596 |
| LEAP-Seq percent confirming: | 5.76923 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAGATGCAGCTACACCT |
| Suggested primer 2: | AGCCTTCGTGATGGAACTGG |