| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.079399 |
| Chromosome: | plastome |
| Location: | 25633 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802275 | rps19,ChreCp013,2717056 | 30S ribosomal protein S19; (1 of 1) K02965 - small subunit ribosomal protein S19 (RP-S19, rpsS) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGTTTCCTAAACTAATTTCTATAAACTACTATTCTTTGCAGTTAACCG |
| Internal bar code: | AAGATTGTCGGTACTCAGTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 434 |
| LEAP-Seq percent confirming: | 6.25 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTTTGGCAGCGTTCATG |
| Suggested primer 2: | CTGCCACTGACGTCCACTAA |