| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.079415 |
| Chromosome: | chromosome 12 |
| Location: | 165738 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g484400 | FKM7 | DNA methylase in the FkbM family; (1 of 13) PF05050 - Methyltransferase FkbM domain (Methyltransf_21) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGTGCCCGCGCCGCAAGCTCGCAACATGGCATTCGCATGAAAGTATTT |
| Internal bar code: | GTCGAAATAATTGCCAGCCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1533 |
| LEAP-Seq percent confirming: | 21.6216 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTGGGACATTGGCTGGAT |
| Suggested primer 2: | GCTCTGCGTTGCGTGATTAG |