| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.079419 |
| Chromosome: | chromosome 17 |
| Location: | 4748067 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g733100 | (1 of 1) IPR000104//IPR003882 - Antifreeze protein, type I // Pistil-specific extensin-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATGGCCGTTCGCGTGGCGACGGTTGTGTCTTCAGGATCAGAAGCTAA |
| Internal bar code: | TGACAAAACGCTGTTGGGTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 605 |
| LEAP-Seq percent confirming: | 8.69565 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATTGCCGAGGAAGGTGAC |
| Suggested primer 2: | CACGCGCGCAACATTACATA |