Insertion junction: LMJ.RY0402.038401_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038401
Chromosome:chromosome_10
Location:2321389
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre10.g434800 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):AGGTGCAGTGGTGACCAGCCACACGCATTG
Internal bar code:AGAGTGGACCCACGAGCGGCGA

Confirmation - LEAP-Seq

LEAP-Seq distance:684
LEAP-Seq percent confirming:96.4696
LEAP-Seq n confirming:1175
LEAP-Seq n nonconfirming:43
LEAP-Seq n unique pos:14

Suggested primers for confirmation by PCR

Suggested primer 1:GTTCAGACCGCGACTTCTTC
Suggested primer 2:AAAGTGAGCAATGATGCACG