Insertion junction: LMJ.RY0402.038403_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.038403
Chromosome:chromosome_4
Location:1999366
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre04.g218800 THB3 Truncated hemoglobin antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CCTGATGGCGTTGGGGCTAAGGACTGAGGA
Internal bar code:ATGGTTGTCCCTTCACGTCAGG

Confirmation - LEAP-Seq

LEAP-Seq distance:846
LEAP-Seq percent confirming:99.5526
LEAP-Seq n confirming:890
LEAP-Seq n nonconfirming:4
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:AGGTGTCAACCGACTGCTCT
Suggested primer 2:GCTACGCTTCAGAATTTGCC