Insertion junction: LMJ.RY0402.038403_2


Insertion cassette:CIB1
Side of cassette:3'
Confidence (%):95
Locus systematic id Locus common name Defline Orientation Feature
Cre04.g218800 THB3 Truncated hemoglobin antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CCGTTCCCAAGACCGCCCCCGCCACCGTTT

Confirmation - LEAP-Seq

LEAP-Seq distance:1010
LEAP-Seq percent confirming:99.3573
LEAP-Seq n confirming:2319
LEAP-Seq n nonconfirming:15
LEAP-Seq n unique pos:13

Suggested primers for confirmation by PCR