Insertion junction: LMJ.RY0402.038404_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.038404
Chromosome:chromosome_13
Location:4625016
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre13.g604050 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CCCGCCAGGAGGGGCCGGCGGCGCAGCGCG
Internal bar code:GTACCTCCTTTATGCCTAGCTT

Confirmation - LEAP-Seq

LEAP-Seq distance:742
LEAP-Seq percent confirming:99.5885
LEAP-Seq n confirming:7502
LEAP-Seq n nonconfirming:31
LEAP-Seq n unique pos:12

Suggested primers for confirmation by PCR

Suggested primer 1:GCTGTTCTTCCTGCTCAACC
Suggested primer 2:CATCGTCAATGGTGTTAGCG