Insertion junction: LMJ.RY0402.038412_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.038412
Chromosome:chromosome_1
Location:3954555
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre01.g025750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TTGGCGCCCGTGTGCAGCCTTGCAAAGCTA
Internal bar code:TAATCCTTCAGGCATCGCGTTC

Confirmation - LEAP-Seq

LEAP-Seq distance:758
LEAP-Seq percent confirming:80.5535
LEAP-Seq n confirming:2183
LEAP-Seq n nonconfirming:527
LEAP-Seq n unique pos:8

Suggested primers for confirmation by PCR

Suggested primer 1:TACTAGCCTTGCCCTCCTCA
Suggested primer 2:AACCTGACTACGGATGTGCC