Insertion junction: LMJ.RY0402.038412_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038412
Chromosome:chromosome_1
Location:3954577
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre01.g025750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CGTGCTGCTTGCATGCTGATTGACGTAGTG
Internal bar code:GGTGAGTTTCCCCCATGGATTA

Confirmation - LEAP-Seq

LEAP-Seq distance:515
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:4
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:TACTAGCCTTGCCCTCCTCA
Suggested primer 2:AACCTGACTACGGATGTGCC