Insertion junction: LMJ.RY0402.038412_3

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038412
Chromosome:chromosome_1
Location:3954577
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre01.g025750 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CGTGCTGCTTGCATGCTGATTGACGTAGTG
Internal bar code:GGTGAGTTTCCACCATGGATTA

Confirmation - LEAP-Seq

LEAP-Seq distance:985
LEAP-Seq percent confirming:99.4321
LEAP-Seq n confirming:5253
LEAP-Seq n nonconfirming:30
LEAP-Seq n unique pos:50

Suggested primers for confirmation by PCR

Suggested primer 1:TACTAGCCTTGCCCTCCTCA
Suggested primer 2:AACCTGACTACGGATGTGCC