Insertion junction: LMJ.RY0402.038421_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.038421
Chromosome:chromosome_10
Location:5081300
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre10.g455950 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CTCGCACTTATTCGTATGTGCCGCCGCGGC
Internal bar code:TTACGAAGTCATGCAATTTATG

Confirmation - LEAP-Seq

LEAP-Seq distance:494
LEAP-Seq percent confirming:99.7132
LEAP-Seq n confirming:6257
LEAP-Seq n nonconfirming:18
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:TGGGAATGTCGTAGTGTCCA
Suggested primer 2:GCCATTGCTAAAAAGCTTGC