Insertion junction: LMJ.RY0402.038422_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038422
Chromosome:chromosome_16
Location:148020
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g695200 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GTACAGGATCGTGTAGGGGCAAGTGTCACA
Internal bar code:GACAAGGGAGTGCTTACGCGCG

Confirmation - LEAP-Seq

LEAP-Seq distance:307
LEAP-Seq percent confirming:34.6004
LEAP-Seq n confirming:2130
LEAP-Seq n nonconfirming:4026
LEAP-Seq n unique pos:10

Suggested primers for confirmation by PCR

Suggested primer 1:GCTAGCATCTGGTAGTGCCC
Suggested primer 2:ATAGCAGCTTGCAACACACG