Insertion junction: LMJ.RY0402.038422_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.038422
Chromosome:chromosome_16
Location:148025
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g695200 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGTACGGACTGTGCTTCCCCTCGCCTTGCC
Internal bar code:CGATTTTGTCCTCCCTGTGCAA

Confirmation - LEAP-Seq

LEAP-Seq distance:73
LEAP-Seq percent confirming:96.875
LEAP-Seq n confirming:93
LEAP-Seq n nonconfirming:3
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR

Suggested primer 1:GCTAGCATCTGGTAGTGCCC
Suggested primer 2:ATAGCAGCTTGCAACACACG