Insertion junction: LMJ.RY0402.038422_3

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038422
Chromosome:chromosome_16
Location:3946253
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g690509 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CTCCCTGATTCAGGGCCGTACGGAGATACA
Internal bar code:ATGGGGGAGTAGATCTTGTCCC

Confirmation - LEAP-Seq

LEAP-Seq distance:363
LEAP-Seq percent confirming:99.1037
LEAP-Seq n confirming:5860
LEAP-Seq n nonconfirming:53
LEAP-Seq n unique pos:33

Suggested primers for confirmation by PCR

Suggested primer 1:GGGATACGGGTTTCCCTAAA
Suggested primer 2:TGCTCATCAGCAATTTAGCG