Insertion junction: LMJ.RY0402.038423_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038423
Chromosome:chromosome_9
Location:2142912
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre09.g393450 FAP233 Flagellar Associated Protein sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CAGCTGTGGGCGGGCGTGTACGGCGAGGGC
Internal bar code:TTACCTGTGCACGGCGGTTCGT

Confirmation - LEAP-Seq

LEAP-Seq distance:760
LEAP-Seq percent confirming:98.5204
LEAP-Seq n confirming:3529
LEAP-Seq n nonconfirming:53
LEAP-Seq n unique pos:15

Suggested primers for confirmation by PCR

Suggested primer 1:CGCTCCTAACCTTTACGTCG
Suggested primer 2:TGTAGAGCGTGATGACCTGG