Insertion junction: LMJ.RY0402.038444_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038444
Chromosome:chromosome_12
Location:6516940
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre12.g538750 LSM1 U6 snRNA-associated Sm-like protein LSm1 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):AACCTTACTGCAGGTGTACTGAAGCCAGGC
Internal bar code:GGAGGGCAGGAGGCGCGCACGT

Confirmation - LEAP-Seq

LEAP-Seq distance:912
LEAP-Seq percent confirming:99.3466
LEAP-Seq n confirming:3801
LEAP-Seq n nonconfirming:25
LEAP-Seq n unique pos:14

Suggested primers for confirmation by PCR

Suggested primer 1:GAACAGGAAGATGCGAAAGC
Suggested primer 2:TGTCGAGGTTCCTTCTGCTT