Insertion junction: LMJ.RY0402.038445_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.038445
Chromosome:chromosome_10
Location:881539
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre10.g424000 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGCATGCCGTGATGCTATCGCAGGCCAAAG
Internal bar code:ACATTGATCATTGGGAGCTGGT

Confirmation - LEAP-Seq

LEAP-Seq distance:194
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:123
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR

Suggested primer 1:CCTCTGCTGTGCCCTCTACT
Suggested primer 2:ATAACGTTTGGACTGCGGAC