Insertion junction: LMJ.RY0402.038447_1


Insertion cassette:CIB1
Side of cassette:3'
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre03.g149700 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):AACACGTGGGATTCGTACGGTTTCCACTTG

Confirmation - LEAP-Seq

LEAP-Seq distance:894
LEAP-Seq percent confirming:99.643
LEAP-Seq n confirming:2791
LEAP-Seq n nonconfirming:10
LEAP-Seq n unique pos:17

Suggested primers for confirmation by PCR