Insertion junction: LMJ.RY0402.038447_2


Insertion cassette:CIB1
Side of cassette:5'
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre03.g149700 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TTCTGTCTGTGGCACCCTTCTTCAAAGGCA

Confirmation - LEAP-Seq

LEAP-Seq distance:50
LEAP-Seq percent confirming:83.7607
LEAP-Seq n confirming:196
LEAP-Seq n nonconfirming:38
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR