Insertion junction: LMJ.RY0402.038447_3

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038447
Chromosome:chromosome_9
Location:6541203
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre09.g407801 AKC1 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CTAGTGTCGCTACGGCCTGCTACTCCCTTA
Internal bar code:GCAGCTGCTTCGAAAAGCCTGG

Confirmation - LEAP-Seq

LEAP-Seq distance:947
LEAP-Seq percent confirming:99.7292
LEAP-Seq n confirming:3314
LEAP-Seq n nonconfirming:9
LEAP-Seq n unique pos:17

Suggested primers for confirmation by PCR

Suggested primer 1:AACAATGCGTTTGCTCTGTG
Suggested primer 2:ATTTGTATGTCGGCAGGAGG