Insertion junction: LMJ.RY0402.038447_4


Insertion cassette:CIB1
Side of cassette:5'
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre09.g407801 AKC1 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GAGTGGCACACGCGCGGACGCGCGATTGGG

Confirmation - LEAP-Seq

LEAP-Seq distance:221
LEAP-Seq percent confirming:97.832
LEAP-Seq n confirming:361
LEAP-Seq n nonconfirming:8
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR