Insertion junction: LMJ.RY0402.038448_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.038448
Chromosome:chromosome_16
Location:6161874
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g675400 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):AAACATGCTGTGTATTGGGTGCTGCGCCAG
Internal bar code:GAGGCGTGTCTCCCGGGTTGAA

Confirmation - LEAP-Seq

LEAP-Seq distance:1002
LEAP-Seq percent confirming:98.7958
LEAP-Seq n confirming:3610
LEAP-Seq n nonconfirming:44
LEAP-Seq n unique pos:16

Suggested primers for confirmation by PCR

Suggested primer 1:ACAGCACGACCGCTAAGAAT
Suggested primer 2:CTCAGCAGTCTCCAGTTCCC