Insertion junction: LMJ.RY0402.038449_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038449
Chromosome:chromosome_10
Location:2920914
Confidence (%):95
Locus systemic id Locus common name Defline Orientation Feature
Cre10.g440250 PGM19 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GTCTTAGGCAGCGGATGGTCAGCTGGGCGG
Internal bar code:CACGCAGCGGTAGTGCGGCCCG

Confirmation - LEAP-Seq

LEAP-Seq distance:526
LEAP-Seq percent confirming:99.627
LEAP-Seq n confirming:2137
LEAP-Seq n nonconfirming:8
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:GGACTTGCCTCAGTTCTTCG
Suggested primer 2:GACGATGTTCGAGTTGCTGA