Insertion junction: LMJ.RY0402.038449_2


Insertion cassette:CIB1
Side of cassette:5'
Confidence (%):95
Locus systematic id Locus common name Defline Orientation Feature
Cre10.g440250 PGM19 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):ATAAAGCGCATTGCGCAAATCGGCATCCAC

Confirmation - LEAP-Seq

LEAP-Seq distance:322
LEAP-Seq percent confirming:99.3939
LEAP-Seq n confirming:164
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR