Insertion junction: LMJ.RY0402.038451_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038451
Chromosome:chromosome_1
Location:5201767
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre01.g036200 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ATGCCGAGCGTCTGATGTCACACTTGTGTT
Internal bar code:GCTTGCCTGTTGGCAGGTAGAC

Confirmation - LEAP-Seq

LEAP-Seq distance:922
LEAP-Seq percent confirming:93.9124
LEAP-Seq n confirming:6001
LEAP-Seq n nonconfirming:389
LEAP-Seq n unique pos:51

Suggested primers for confirmation by PCR

Suggested primer 1:TGATATCTGTCAGGGCCACA
Suggested primer 2:AACACAGCAATGAAGGGGAC