Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.038451 |
Chromosome: | chromosome 1 |
Location: | 5201767 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g036200 | (1 of 1) PF01477//PF07228 - PLAT/LH2 domain (PLAT) // Stage II sporulation protein E (SpoIIE) (SpoIIE) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCGAGCGTCTGATGTCACACTTGTGTT |
Internal bar code: | GCTTGCCTGTTGGCAGGTAGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 922 |
LEAP-Seq percent confirming: | 93.9124 |
LEAP-Seq n confirming: | 6001 |
LEAP-Seq n nonconfirming: | 389 |
LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGATATCTGTCAGGGCCACA |
Suggested primer 2: | AACACAGCAATGAAGGGGAC |