Insertion junction: LMJ.RY0402.038453_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.038453
Chromosome:chromosome_16
Location:6542101
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre16.g672602 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TCACCAGCCGCCTGTAGACACCATGGGCAC
Internal bar code:GGGATACATACGTCGCGTGTGA

Confirmation - LEAP-Seq

LEAP-Seq distance:752
LEAP-Seq percent confirming:97.4654
LEAP-Seq n confirming:4153
LEAP-Seq n nonconfirming:108
LEAP-Seq n unique pos:18

Suggested primers for confirmation by PCR

Suggested primer 1:AATACACGTTTGTCCCGCTC
Suggested primer 2:GTGGGATAGTGGTCGCACTT